About   Help   FAQ
Tmsb10em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmsb10em1(IMPC)J
Name: thymosin beta 10; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7485946
Gene: Tmsb10  Location: Chr6:72934330-72935731 bp, - strand  Genetic Position: Chr6, 32.35 cM
Alliance: Tmsb10em1(IMPC)J page
IMPC: Tmsb10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGGAGTGAGTTGTGCCGCA and TTAGGAACGCGGGCCGAGAA, which resulted in a 1282 bp deletion beginning at Chromosome 6 position 72,957,282 bp and ending after 72,958,563 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000697927 and ENSMUSE00000697926 (exons 1 and 2) and 592 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tmsb10 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory