About   Help   FAQ
Mdm21m1.1Dwg
Targeted Allele Detail
Summary
Symbol: Mdm21m1.1Dwg
Name: MDM2 proto-oncogene; targeted mutation 1.1, David W Goodrich
MGI ID: MGI:7485930
Synonyms: Mdm2L466A, Mdm2la
Gene: Mdm2  Location: Chr10:117524780-117546663 bp, - strand  Genetic Position: Chr10, 66.32 cM, cytoband C1-C3
Alliance: Mdm21m1.1Dwg page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:325001
Parent Cell Line:  W4 (ES Cell)
Strain of Origin:  129S6/SvEvTac
Mutation
description
Allele Type:    Targeted (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsExons 10-12 were targeted with a modified BAC that contains an FRT site flanked neomycin resistance gene cassette in intron 9 and an exon 12 where leucine codon 466 (CTA) was changed to alanine (GCA) (p.L466A). Recombination was aided by CRISPR/Cas9 editing with an sgRNA (targeting GCATTGTTCACGGCAAGACTGG). The neo cassette was removed through subsequent Flp-mediated recombination. The mutation is the equivalent of the human p.L468A mutation that abolishes human MDM2 (HDM2)-mediated p53 multi-monoubiquitination and HDM2-MDM4 mediated p53 polyubiquitination. (J:325001)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mdm2 Mutation:  51 strains or lines available
References
Original:  J:325001 Chinnam M, et al., MDM2 E3 ligase activity is essential for p53 regulation and cell cycle integrity. PLoS Genet. 2022 May;18(5):e1010171
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory