About   Help   FAQ
Trex1em1Qiche
Endonuclease-mediated Allele Detail
Summary
Symbol: Trex1em1Qiche
Name: three prime repair exonuclease 1; endonuclease-mediated mutation 1, Qi Chen
MGI ID: MGI:7485808
Synonyms: Trex1D18N
Gene: Trex1  Location: Chr9:108887000-108888791 bp, - strand  Genetic Position: Chr9, 59.63 cM
Alliance: Trex1em1Qiche page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsAspartic acid codon 18 (GAC) was changed to asparagine (AAT) (p.D18N) using an sgRNA (targeting CCACTGGCCTGCCTTCGTCT) and an ssODN template with CRISPR/Cas9 technology. The equivalent human mutation is associated with familial chilblain lupus (FCL). (J:295560)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Trex1 Mutation:  29 strains or lines available
References
Original:  J:295560 Xiao N, et al., cGAS activation causes lupus-like autoimmune disorders in a TREX1 mutant mouse model. J Autoimmun. 2019 Jun;100:84-94
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory