About   Help   FAQ
Adarem2Qwan
Endonuclease-mediated Allele Detail
Summary
Symbol: Adarem2Qwan
Name: adenosine deaminase, RNA-specific; endonuclease-mediated mutation 2, Qingde Wang
MGI ID: MGI:7484719
Synonyms: ADAR1 P195A, AdarP193A
Gene: Adar  Location: Chr3:89622329-89660753 bp, + strand  Genetic Position: Chr3, 39.19 cM, cytoband F2
Alliance: Adarem2Qwan page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsProline codon 195 was changed to alanine (c.583C>G p.P195A) using an sgRNA (targeting GCAAGGCAAGCTTCGCACCA) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.P193A mutation associated with Aicardi-Goutieres syndrome (AGS). (J:325221)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Adar Mutation:  83 strains or lines available
References
Original:  J:325221 Guo X, et al., Aicardi-Goutieres syndrome-associated mutation at ADAR1 gene locus activates innate immune response in mouse brain. J Neuroinflammation. 2021 Jul 31;18(1):169
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory