About   Help   FAQ
Ccser2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccser2em1(IMPC)J
Name: coiled-coil serine rich 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7484552
Gene: Ccser2  Location: Chr14:36596893-36690734 bp, - strand  Genetic Position: Chr14, 21.29 cM, cytoband B
Alliance: Ccser2em1(IMPC)J page
IMPC: Ccser2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTATTGAGAAGTGCCCCT and CAAATGCTGTTATAATAGAT, which resulted in a 465 bp deletion beginning at Chromosome 14 position 36,938,415 bp and ending after 36,938,879 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001237712 (exon 3) and 268 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 471 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccser2 Mutation:  58 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory