About   Help   FAQ
Retem2Heno
Endonuclease-mediated Allele Detail
Summary
Symbol: Retem2Heno
Name: ret proto-oncogene; endonuclease-mediated mutation 2, Hideki Enomoto
MGI ID: MGI:7484390
Synonyms: RetY792F
Gene: Ret  Location: Chr6:118128706-118174679 bp, - strand  Genetic Position: Chr6, 55.86 cM, cytoband E3-F1
Alliance: Retem2Heno page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsTyrosine codon 792 (TAT) was changed to phenylalanine (TTT) (p.Y792F) using an sgRNA (targeting ACATGTCATCAAGTTGTATGGGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.Y791F mutation associated with Hirschsprung disease (HSCR). (J:325770)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ret Mutation:  52 strains or lines available
References
Original:  J:325770 Nakatani T, et al., Point mutagenesis in mouse reveals contrasting pathogenetic effects between MEN2B- and Hirschsprung disease-associated missense mutations of the RET gene. Dev Growth Differ. 2020 May;62(4):214-222
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory