About   Help   FAQ
Il2rgem3Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Il2rgem3Lutzy
Name: interleukin 2 receptor, gamma chain; endonuclease-mediated mutation 3, Cathy Lutz
MGI ID: MGI:7482336
Synonyms: Il2rg KO
Gene: Il2rg  Location: ChrX:100307991-100311861 bp, - strand  Genetic Position: ChrX, 43.9 cM
Alliance: Il2rgem3Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsGuide RNAs were selected to target upstream [GACCAGATGAGGCTAGCTAA ; GCCCATTAGCTAGCCTCATC] and downstream [GTTTATAGATTGTTGGCCAT ; TATCTTCTCTTTTCTGCCCA] of exon 3. Donor DNAs were originally designed to introduce loxP sequences flanking exon 3. Il2rg transcript Il2rg-201 was used as reference for the exon number and the guide sequences. DNA sequencing of the targeted region identified a 334 nt deletion (indel mutation)[CATTGTCAGTTCAGAC//CAGAAAAGAGAAGAT]. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Il2rg Mutation:  133 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory