Txnip^em1Ngwu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Txnip^em1Ngwu
• Name: thioredoxin interacting protein; endonuclease-mediated mutation 1, Ning Wu
• MGI ID: MGI:7482010
• Synonyms: NTX
• Gene: Txnip Location: Chr3:96465273-96469173 bp, + strand Genetic Position: Chr3, 41.93 cM, cytoband F2.2
• Alliance: Txnip^em1Ngwu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 endonuclease-mediated genome editing using crRNA/tracrRNA duplex gRNA (crRNA: GAACCCACUCGGCUCAAUCAGUUUUAGAGCUAUGCU, universal tracer RNA: AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU) is designed to insert an N-terminal double HA tag immediately downstream of the initial Met start codon with SerGlyGly as the linker peptide. (J:335573)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Txnip Mutation: 48 strains or lines available

References

• Original: J:335573 Waldhart AN, et al., Optimal HSF1 activation in response to acute cold stress in BAT requires nuclear TXNIP. iScience. 2023 May 19;26(5):106538
• All: 1 reference(s)