Scaf8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scaf8^em1(IMPC)J
• Name: SR-related CTD-associated factor 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7481978
• Gene: Scaf8 Location: Chr17:3165247-3249134 bp, + strand Genetic Position: Chr17, 1.96 cM
• Alliance: Scaf8^em1(IMPC)J page
• IMPC: Scaf8 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GAGAGACTAAAATAGTTCAG and GTTCACACGCTATAGGGCAG that targeted exon(s) ENSMUSE00000345755.2. This resulted in deletion(s) of 133 bp (location: Chr17:3213006-3213138; GRCm39), 320 bp (location: Chr17:3213143-3213462; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Scaf8 Mutation: 106 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)