About   Help   FAQ
Endod1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Endod1em1(IMPC)J
Name: endonuclease domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7481964
Gene: Endod1  Location: Chr9:14265286-14292538 bp, - strand  Genetic Position: Chr9, 3.96 cM, cytoband A3
Alliance: Endod1em1(IMPC)J page
IMPC: Endod1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTACTTTAGACAATTCCG and TGACCCTGACAGCAACCTCG, which resulted in a 1172 bp deletion beginning at Chromosome 9 position 14,356,695 bp and ending after 14,357,866 bp (GRCm38/mm10). This mutation deletes 1172 bp from ENSMUSE00000361525 (exon 2) and is predicted to cause a change of amino acid sequence after residue 107 and early truncation 21 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Endod1 Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory