About   Help   FAQ
Rab9bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab9bem1(IMPC)J
Name: RAB9B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackso
MGI ID: MGI:7481929
Gene: Rab9b  Location: ChrX:135758896-135769305 bp, - strand  Genetic Position: ChrX, 59.1 cM
Alliance: Rab9bem1(IMPC)J page
IMPC: Rab9b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATCAAGTACCATCTAAGTG and TTATGTAAGTACATTGTCAG, which resulted in a 3744 bp deletion beginning at Chromosome X position 136,858,051 bp and ending after 136,861,794 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000409412 (exon 3) and 199 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rab9b Mutation:  7 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory