Rab9b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab9b^em1(IMPC)J
• Name: RAB9B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackso
• MGI ID: MGI:7481929
• Gene: Rab9b Location: ChrX:135758896-135769305 bp, - strand Genetic Position: ChrX, 59.1 cM
• Alliance: Rab9b^em1(IMPC)J page
• IMPC: Rab9b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATCAAGTACCATCTAAGTG and TTATGTAAGTACATTGTCAG, which resulted in a 3744 bp deletion beginning at Chromosome X position 136,858,051 bp and ending after 136,861,794 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000409412 (exon 3) and 199 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rab9b Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)