Lrrc40^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrrc40^em1(IMPC)J
• Name: leucine rich repeat containing 40; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7481915
• Gene: Lrrc40 Location: Chr3:157742340-157772727 bp, + strand Genetic Position: Chr3, 81.65 cM, cytoband H4
• Alliance: Lrrc40^em1(IMPC)J page
• IMPC: Lrrc40 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAATTTCTGGACAGCAGTT and GATGCTGTATTCTACCCAAG, which resulted in a 358 bp deletion beginning at Chromosome 3 position 158,041,427 bp and ending after 158,041,784 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000471787 (exon 3) and 284 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 111 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lrrc40 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)