Knl1em1Svap
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Knl1em1Svap |
| Name: |
kinetochore scaffold 1; endonuclease-mediated mutation 1, Svante Paabo |
| MGI ID: |
MGI:7470780 |
| Synonyms: |
hKNL1 |
| Gene: |
Knl1 Location: Chr2:118877600-118935982 bp, + strand Genetic Position: Chr2, 59.85 cM, cytoband E5
|
| Alliance: |
Knl1em1Svap page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details:
Histidine codon 109 (CAT) was changed to arginine (CGC) (p.H109R) and glycine codon 910 (GGC) to serine (TCC) (p.G910S) using sgRNAs (targeting CATTTGCATGTTTCCTTTCA and TTTCTGAATGAACTTCTGTC) and ssODN templates with CRISPR/Cas9 technology. These mutations change the mouse residues to the residues found in the orthologous human gene (R159, S1086).
(J:327275)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Knl1 Mutation: |
102 strains or lines available
|
|
| Original: |
J:327275 Mora-Bermudez F, et al., Longer metaphase and fewer chromosome segregation errors in modern human than Neanderthal brain development. Sci Adv. 2022 Jul 29;8(30):eabn7702 |
| All: |
1 reference(s) |
|