About   Help   FAQ
Kif18aem1Svap
Endonuclease-mediated Allele Detail
Summary
Symbol: Kif18aem1Svap
Name: kinesin family member 18A; endonuclease-mediated mutation 1, Svante Paabo
MGI ID: MGI:7470779
Synonyms: hKIF18a
Gene: Kif18a  Location: Chr2:109111165-109172094 bp, + strand  Genetic Position: Chr2, 56.55 cM
Alliance: Kif18aem1Svap page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 67 (AGG) was changed to lysine (AAA) (p.R67K) using an sgRNA (targeting CAAATTTTGATATTACTAAA) and an ssODN template with CRISPR/Cas9 technology. This mutation changes the mouse residue to the residue found in the orthologous human gene. (J:327275)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Kif18a Mutation:  63 strains or lines available
References
Original:  J:327275 Mora-Bermudez F, et al., Longer metaphase and fewer chromosome segregation errors in modern human than Neanderthal brain development. Sci Adv. 2022 Jul 29;8(30):eabn7702
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory