Mxra8^em#Wehi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mxra8^em#Wehi
• Name: matrix-remodelling associated 8; endonuclease-mediated mutation, Walter and Eliza Hall Institute of Medical Research
• MGI ID: MGI:7469456
• Gene: Mxra8 Location: Chr4:155924137-155928545 bp, + strand Genetic Position: Chr4, 87.58 cM, cytoband E2
• Alliance: Mxra8^em#Wehi page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs GCTATCCATCGTGACGACTC and GCCACGAGGGACTTTGCAT generated a knock-out allele. Several founders were generated (number 4, 6, 8, 9, 10, and 11). The pound symbol (#) is used when line is not specified and/or lines are pooled. (J:335209)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mxra8 Mutation: 32 strains or lines available

References

• Original: J:335209 Ng WH, et al., Role of MXRA8 in Ross River Virus Disease Pathogenesis. mBio. 2023 Apr 25;14(2):e0058823
• All: 1 reference(s)