Pgbd5^em1Aken
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pgbd5^em1Aken
• Name: piggyBac transposable element derived 5; endonuclease-mediated mutation 1, Alex Kentsis
• MGI ID: MGI:7469447
• Synonyms: Pgbd5^D262A, Pgbd5^ki
• Gene: Pgbd5 Location: Chr8:125095788-125161230 bp, - strand Genetic Position: Chr8, 72.65 cM
• Alliance: Pgbd5^em1Aken page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 endonuclease-mediated genome editing is used to create an aspartate to alanine substitution at codon 262 in exon 2. The mutation is changes the aspartate residue needed for cellular DNA activity to an inactive alanine. The crRNA and tracrRNA sequences are as follows; crRNA #1 for D/A on Exon 2, sequence (AGCCACTCTGCAGGGAGTCG), crRNA #2 for D/A on Exon 3, sequence (ACATGAACCCCTGATTGACG); tracrRNA. (J:335226)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pgbd5 Mutation: 35 strains or lines available

References

• Original: J:335226 Zapater LJ, et al., A transposase-derived gene required for human brain development. bioRxiv. 2023 May 23
• All: 2 reference(s)