About   Help   FAQ
Exo1em1Wed
Endonuclease-mediated Allele Detail
Summary
Symbol: Exo1em1Wed
Name: exonuclease 1; endonuclease-mediated mutation 1, Winfried Edelmann
MGI ID: MGI:7468985
Synonyms: Exo1A, EXO1D173A, Exo1DA
Gene: Exo1  Location: Chr1:175708334-175738962 bp, + strand  Genetic Position: Chr1, 81.9 cM
Alliance: Exo1em1Wed page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Hypomorph)
Mutation:    Single point mutation
 
Mutation detailsAspartic acid codon 173 (GAC) was changed to alanine (GCC) (p.D173A) using an sgRNA (targeting GACTCTGACCTCCTCGCATTTGG) and an ssODN template with CRISPR/Cas9 technology. The highly conserved mutated residue is located in the exonuclease site. (J:327354)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Exo1 Mutation:  45 strains or lines available
References
Original:  J:327354 Wang S, et al., Role of EXO1 nuclease activity in genome maintenance, the immune response and tumor suppression in Exo1D173A mice. Nucleic Acids Res. 2022 Aug 12;50(14):8093-8106
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory