Ankrd34a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ankrd34a^em1(IMPC)J
• Name: ankyrin repeat domain 34A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7468702
• Gene: Ankrd34a Location: Chr3:96503952-96507091 bp, + strand Genetic Position: Chr3, 41.93 cM
• Alliance: Ankrd34a^em1(IMPC)J page
• IMPC: Ankrd34a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGAAGAAGAGCGTGGCCCT and CTTCAGCGCCCGGGTTCCCC, which resulted in a 1457 bp deletion beginning at Chromosome 3 position 96,597,496 bp and ending after 96,598,952 bp (GRCm38/mm10). This mutation deletes 1457 bp from ENSMUSE00000410687 (exon 2) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 24 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ankrd34a Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)