About   Help   FAQ
Ankrd34aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ankrd34aem1(IMPC)J
Name: ankyrin repeat domain 34A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7468702
Gene: Ankrd34a  Location: Chr3:96503952-96507091 bp, + strand  Genetic Position: Chr3, 41.93 cM
Alliance: Ankrd34aem1(IMPC)J page
IMPC: Ankrd34a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGAAGAAGAGCGTGGCCCT and CTTCAGCGCCCGGGTTCCCC, which resulted in a 1457 bp deletion beginning at Chromosome 3 position 96,597,496 bp and ending after 96,598,952 bp (GRCm38/mm10). This mutation deletes 1457 bp from ENSMUSE00000410687 (exon 2) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 24 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ankrd34a Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory