About   Help   FAQ
Endonuclease-mediated Allele Detail
Symbol: Mmgt1em1(IMPC)J
Name: membrane magnesium transporter 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7466961
Gene: Mmgt1  Location: ChrX:55630872-55643304 bp, - strand  Genetic Position: ChrX, 30.06 cM
Alliance: Mmgt1em1(IMPC)J page
IMPC: Mmgt1 gene page
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGCTCCTTTTTTTTTCTG and GCGAGACCAATGGGGAGACG, which resulted in a 12794 bp deletion beginning at Chromosome X position 56,585,378 bp and ending after 56,598,171 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000436074, ENSMUSE00000364351, ENSMUSE00000412050, ENSMUSE00000366591 (exons 1-4) and 8560 bp of flanking intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mmgt1 Mutation:  4 strains or lines available
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
MGI 6.23
The Jackson Laboratory