Dpy19l4em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Dpy19l4em1(IMPC)J |
Name: |
dpy-19 like 4; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7466927 |
Gene: |
Dpy19l4 Location: Chr4:11261315-11322137 bp, - strand Genetic Position: Chr4, 5.11 cM
|
Alliance: |
Dpy19l4em1(IMPC)J page
|
IMPC: |
Dpy19l4 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTACAGCAAGCGCTTAGAC and AAGAATACCCTACAAACAGC, which resulted in a 1497 bp deletion beginning at Chromosome 4 position 11,303,116 bp and ending after 11,304,612 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291800, ENSMUSE00001305659, ENSMUSE00000385379 (exons 4, 5, 6) and 1138 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 84 amino acids later. 61 bp before the deletion site there is an indel with 2 bp insertion (AA) and 5 bp deletion (CTGCT).
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|