About   Help   FAQ
Dpy19l4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dpy19l4em1(IMPC)J
Name: dpy-19 like 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7466927
Gene: Dpy19l4  Location: Chr4:11261315-11322137 bp, - strand  Genetic Position: Chr4, 5.11 cM
Alliance: Dpy19l4em1(IMPC)J page
IMPC: Dpy19l4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTACAGCAAGCGCTTAGAC and AAGAATACCCTACAAACAGC, which resulted in a 1497 bp deletion beginning at Chromosome 4 position 11,303,116 bp and ending after 11,304,612 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291800, ENSMUSE00001305659, ENSMUSE00000385379 (exons 4, 5, 6) and 1138 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 84 amino acids later. 61 bp before the deletion site there is an indel with 2 bp insertion (AA) and 5 bp deletion (CTGCT). (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dpy19l4 Mutation:  52 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory