About   Help   FAQ
Scn9aem1Wlf
Endonuclease-mediated Allele Detail
Summary
Symbol: Scn9aem1Wlf
Name: sodium channel, voltage-gated, type IX, alpha; endonuclease-mediated mutation 1, Clifford J Woolf
MGI ID: MGI:7466218
Synonyms: Nav1.7I228M
Gene: Scn9a  Location: Chr2:66310424-66465306 bp, - strand  Genetic Position: Chr2, 39.13 cM
Alliance: Scn9aem1Wlf page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:329231
Parent Cell Line:  iTL BF1 (ES Cell)
Strain of Origin:  C57BL/6NTac
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsIsoleucine codon 228 (ATT) in exon 6 was changed to methionine (ATG) using two sgRNAs (targeting ATTCCAGGTAAGAAGTGATTGG and CACACCAATCACTTCTTACCTGG) and an ssODN template (CAGCTCTTCGAACTTTCAGAGTCTTGAGAGCTTTGAAAACTATTTCCGTTATGCCGGGAAAGAAGTGATTGGTGTGGAGCTTTAGACTGCTCAACTCCAGCTG) using CRISPR/Cas9 technology. The equivalent human mutation is associated with small fiber neuropathy (SFN). (J:329231)
Inheritance:    Recessive
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Scn9a Mutation:  124 strains or lines available
References
Original:  J:329231 Chen L, et al., Two independent mouse lines carrying the Nav1.7 I228M gain-of-function variant display dorsal root ganglion neuron hyperexcitability but a minimal pain phenotype. Pain. 2021 Jun 1;162(6):1758-1770
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory