Scn9a^em1Wlf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scn9a^em1Wlf
• Name: sodium channel, voltage-gated, type IX, alpha; endonuclease-mediated mutation 1, Clifford J Woolf
• MGI ID: MGI:7466218
• Synonyms: Nav1.7^I228M
• Gene: Scn9a Location: Chr2:66310424-66465306 bp, - strand Genetic Position: Chr2, 39.13 cM
• Alliance: Scn9a^em1Wlf page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:329231
• Parent Cell Line: iTL BF1 (ES Cell)
• Strain of Origin: C57BL/6NTac

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Isoleucine codon 228 (ATT) in exon 6 was changed to methionine (ATG) using two sgRNAs (targeting ATTCCAGGTAAGAAGTGATTGG and CACACCAATCACTTCTTACCTGG) and an ssODN template (CAGCTCTTCGAACTTTCAGAGTCTTGAGAGCTTTGAAAACTATTTCCGTTATGCCGGGAAAGAAGTGATTGGTGTGGAGCTTTAGACTGCTCAACTCCAGCTG) using CRISPR/Cas9 technology. The equivalent human mutation is associated with small fiber neuropathy (SFN). (J:329231)
• Inheritance: Recessive

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Scn9a Mutation: 120 strains or lines available

References

• Original: J:329231 Chen L, et al., Two independent mouse lines carrying the Nav1.7 I228M gain-of-function variant display dorsal root ganglion neuron hyperexcitability but a minimal pain phenotype. Pain. 2021 Jun 1;162(6):1758-1770
• All: 2 reference(s)