Scn9aem1Wlf
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Scn9aem1Wlf |
| Name: |
sodium channel, voltage-gated, type IX, alpha; endonuclease-mediated mutation 1, Clifford J Woolf |
| MGI ID: |
MGI:7466218 |
| Synonyms: |
Nav1.7I228M |
| Gene: |
Scn9a Location: Chr2:66310424-66465306 bp, - strand Genetic Position: Chr2, 39.13 cM
|
| Alliance: |
Scn9aem1Wlf page
|
|
| Germline Transmission: |
Earliest citation of germline transmission:
J:329231
|
| Parent Cell Line: |
iTL BF1 (ES Cell)
|
| Strain of Origin: |
C57BL/6NTac
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: Isoleucine codon 228 (ATT) in exon 6 was changed to methionine (ATG) using two sgRNAs (targeting ATTCCAGGTAAGAAGTGATTGG and CACACCAATCACTTCTTACCTGG) and an ssODN template (CAGCTCTTCGAACTTTCAGAGTCTTGAGAGCTTTGAAAACTATTTCCGTTATGCCGGGAAAGAAGTGATTGGTGTGGAGCTTTAGACTGCTCAACTCCAGCTG) using CRISPR/Cas9 technology. The equivalent human mutation is associated with small fiber neuropathy (SFN).
(J:329231)
|
| Inheritance: |
|
Recessive |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Scn9a Mutation: |
124 strains or lines available
|
|
| Original: |
J:329231 Chen L, et al., Two independent mouse lines carrying the Nav1.7 I228M gain-of-function variant display dorsal root ganglion neuron hyperexcitability but a minimal pain phenotype. Pain. 2021 Jun 1;162(6):1758-1770 |
| All: |
2 reference(s) |
|