About   Help   FAQ
Lgals3em1Vari
Endonuclease-mediated Allele Detail
Summary
Symbol: Lgals3em1Vari
Name: lectin, galactose binding, soluble 3; endonuclease-mediated mutation 1, van Andel Research Institute
MGI ID: MGI:7464949
Synonyms: Lgals3-R200SKI, Lgals3tm1Vari
Gene: Lgals3  Location: Chr14:47611317-47623624 bp, + strand  Genetic Position: Chr14, 24.6 cM, cytoband C1
Alliance: Lgals3em1Vari page
Mutation
origin
Strain of Origin:  (C57BL/6J x C3H/HeJ)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 200 (AGA) in exon 5 was changed to serine (TCA) (p.R200S) using two sgRNAs (targeting CACCTTTGCCACTCTCAAAGGGGA and AAACTCCCCTTTGAGAGTGGCAAA) and an ssODN template with CRISPR/Cas9 technology. The mutation disrupts Lgals3 glycan-binding. (J:329549)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Lgals3 Mutation:  28 strains or lines available
References
Original:  J:329549 Maupin KA, et al., Mutation of the galectin-3 glycan-binding domain (Lgals3-R200S) enhances cortical bone expansion in male mice and trabecular bone mass in female mice. FEBS Open Bio. 2022 Oct;12(10):1717-1728
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory