Ncf1em1Nansh
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ncf1em1Nansh |
| Name: |
neutrophil cytosolic factor 1; endonuclease-mediated mutation 1, Nan Shen |
| MGI ID: |
MGI:7464912 |
| Synonyms: |
NCF1 p.R90H |
| Gene: |
Ncf1 Location: Chr5:134248907-134258479 bp, - strand Genetic Position: Chr5, 74.47 cM
|
| Alliance: |
Ncf1em1Nansh page
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: Arginine codon 90 (CGC) in exon 4 was changed to histidine (CAC) (p.R90H) using an sgRNA (targeting ACGAGCCGCTGAGAGTCGCC) and an ssODN template (CATGGGTCTCTGGCTCCCCCACCCAGCACCCAGGTGGTTTGATGGGCAACGAGCAGCTGAGTCCCACCAGGGCACTCTCACTGAATACTTCAACGGCCTCATGGGACTGCCCGTGAAGAT) with CRISPR/Cas9 technology. The mutation (SNP rs201802880) is found in some systemic lupus erythematosus (SLE) patients.
(J:329553)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Ncf1 Mutation: |
40 strains or lines available
|
|
| Original: |
J:329553 Meng Y, et al., The NCF1 variant p.R90H aggravates autoimmunity by facilitating the activation of plasmacytoid dendritic cells. J Clin Invest. 2022 Aug 15;132(16):e153619 |
| All: |
1 reference(s) |
|