About   Help   FAQ
Phyhd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Phyhd1em1(IMPC)J
Name: phytanoyl-CoA dioxygenase domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7464807
Gene: Phyhd1  Location: Chr2:30156215-30172161 bp, + strand  Genetic Position: Chr2, 21.46 cM
Alliance: Phyhd1em1(IMPC)J page
IMPC: Phyhd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
  Phyhd1em1(IMPC)J involves 1 genes/genome features (Gm28035) View all
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACTACAGATGCCTCCTGG and GCTTGCTTTTCTGCACTCCC, which resulted in a 592 bp deletion beginning at Chromosome 2 position 30,274,151 bp and ending after 30,274,742 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000662834 and ENSMUSE00000604424 (exons 4 and 5) and 468 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 61 amino acids later. There is a 7 bp insertion (AGGGGGC)at the deletion site. The deletion also removes non-coding exon 6 ENSMUSE00000734429 from Gm28035. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Phyhd1 Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory