Phyhd1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Phyhd1em1(IMPC)J |
| Name: |
phytanoyl-CoA dioxygenase domain containing 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7464807 |
| Gene: |
Phyhd1 Location: Chr2:30156215-30172161 bp, + strand Genetic Position: Chr2, 21.46 cM
|
| Alliance: |
Phyhd1em1(IMPC)J page
|
| IMPC: |
Phyhd1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
|
|
Phyhd1em1(IMPC)J involves 1 genes/genome features (Gm28035)
View all
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACTACAGATGCCTCCTGG and GCTTGCTTTTCTGCACTCCC, which resulted in a 592 bp deletion beginning at Chromosome 2 position 30,274,151 bp and ending after 30,274,742 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000662834 and ENSMUSE00000604424 (exons 4 and 5) and 468 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 61 amino acids later. There is a 7 bp insertion (AGGGGGC)at the deletion site. The deletion also removes non-coding exon 6 ENSMUSE00000734429 from Gm28035.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|