Rhobtb2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rhobtb2^em1(IMPC)J
• Name: Rho-related BTB domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7464782
• Gene: Rhobtb2 Location: Chr14:70022439-70043085 bp, - strand Genetic Position: Chr14, 36.1 cM, cytoband D1
• Alliance: Rhobtb2^em1(IMPC)J page
• IMPC: Rhobtb2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGCAATTCCGAATAATAAG and CTCCACGCTGAGCGGAAGCA, which resulted in a 3821 bp deletion beginning at Chromosome 14 position 69,796,110 bp and ending after 69,799,930 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000556573, ENSMUSE00000123406, ENSMUSE00000263693 (exons 3,4, and 5) and 2512 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 64 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rhobtb2 Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)