About   Help   FAQ
Rhobtb2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rhobtb2em1(IMPC)J
Name: Rho-related BTB domain containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7464782
Gene: Rhobtb2  Location: Chr14:70022439-70043085 bp, - strand  Genetic Position: Chr14, 36.1 cM, cytoband D1
Alliance: Rhobtb2em1(IMPC)J page
IMPC: Rhobtb2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGCAATTCCGAATAATAAG and CTCCACGCTGAGCGGAAGCA, which resulted in a 3821 bp deletion beginning at Chromosome 14 position 69,796,110 bp and ending after 69,799,930 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000556573, ENSMUSE00000123406, ENSMUSE00000263693 (exons 3,4, and 5) and 2512 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 64 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rhobtb2 Mutation:  38 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory