Defa30^em1Irc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Defa30^em1Irc
• Name: defensin, alpha, 30; endonuclease-mediated mutation 1, Inflammation Research Center
• MGI ID: MGI:7464723
• Gene: Defa30 Location: Chr8:21624658-21625614 bp, + strand Genetic Position: Chr8, 10.35 cM
• Alliance: Defa30^em1Irc page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: This allele was generated by the Transgenic Core Facility (TCF) of the Inflammation Research Center (IRC) of VIB-Ugent by electroporating Cas9 RNP complex with guide RNA sequence 5' CATGGTCATCTTGTTCTCTG 3' and single stranded DNA oligo with sequence 5' AGAAGTGGTCATCAGGCACCAGCGTCAGTGGCCTCAGTACTCATGGTCATCTTGTTCTCTcTGGTCTCCATGTTCAgtggtgatggtgatgatgtccggagccGCGACAGCAGAGCATGTACATTAAATGACCCTTACTGCAGGTCCCATTCATGCGTTCTCT 3' in C57BL/6J zygotes which resulted in the addition of a C-terminal GSG-linker and His-tag to the coding sequence of the gene (ENSMUSG00000074444). The GSG-linker + His-tag was inserted directly before the stop codon of the gene at position (chr8:21625516). All base annotations are according to C57BL/6J genome assembly GRCm39. (J:361591)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Defa30 Mutation: 13 strains or lines available

References

• Original: J:361591 Hochepied T, DDS Inflammation Research Center. MGI Direct Data Submission. 2025
• All: 2 reference(s)