Best3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Best3^em1(IMPC)J
• Name: bestrophin 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7464720
• Gene: Best3 Location: Chr10:116822219-116860945 bp, + strand Genetic Position: Chr10, 65.0 cM
• Alliance: Best3^em1(IMPC)J page
• IMPC: Best3 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGGGTGCATAACACCCGG and AATACTTCCAAGGAGCCTGA, which resulted in a 469 bp deletion beginning at Chromosome 10 position 117,002,370 bp and ending after 117,002,838 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000101368 (exon 5) and 314 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 54 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Best3 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)