Got2^em3Pcamp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Got2^em3Pcamp
• Name: glutamatic-oxaloacetic transaminase 2, mitochondrial; endonuclease-mediated mutation 3, Philippe Campeau
• MGI ID: MGI:7464273
• Synonyms: Got2^emhL209del
• Gene: Got2 Location: Chr8:96590761-96615029 bp, - strand Genetic Position: Chr8, 47.79 cM
• Alliance: Got2^em3Pcamp page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutations: Intragenic deletion, Nucleotide substitutions
• Mutation details: Exon 6 was targeted with an sgRNA (targeting GGTTGTGAGCGCAGGCATGC) and an ssODN template (ACAGCCAAAAATCTCGATTGTTTCTCCTTAGAAAATCCCAGAGCAGAGTGTCTTATTACACGCATGTGCACACAACCCCACCGGCGTGGACCCGCGTCCCGAGCAGTGGAAGGAGATAGCGTCCG) using CRISPR/Cas9 technology to delete one of leucine codons 207, 208 or 209 (p.L209del). The equivalent human mutation (p.Leu209del, NM_002080.2:c.624_626delTCT) is found in some Malate-Aspartate Shuttle (MAS)-Related Encephalopathy patients. (J:291216)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Got2 Mutation: 24 strains or lines available

References

• Original: J:291216 van Karnebeek CDM, et al., Bi-allelic GOT2 Mutations Cause a Treatable Malate-Aspartate Shuttle-Related Encephalopathy. Am J Hum Genet. 2019 Sep 5;105(3):534-548
• All: 1 reference(s)