Got2^em1Pcamp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Got2^em1Pcamp
• Name: glutamatic-oxaloacetic transaminase 2, mitochondrial; endonuclease-mediated mutation 1, Philippe Campeau
• MGI ID: MGI:7464269
• Synonyms: Got2^emhD335fs14*
• Gene: Got2 Location: Chr8:96590761-96615029 bp, - strand Genetic Position: Chr8, 47.79 cM
• Alliance: Got2^em1Pcamp page

Mutation origin

• Strain of Origin: either: C57BL/6J or (C57BL/6 x C3H)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: Exon 8 was targeted with an sgRNA (targeting TCCTGACTTCTCCAGACTTG) and an ssODN template (CCGTCCCCTGTATTCCAACCCACCTCTCAATGGGGCCCGGATCGCAGCAACCATTCTGACGTCTCCGGATTTAGGTAAGCAATGGTAACGATTACTAGCTGTTCCGTGCTACAGCTCCATGAATGGAAAAG) using CRISPR/Cas9 technology with the aim to create a p.R337G mutation. The actual result was an unintended insertion/duplication of a single T (A on forward strand, after chr8:96596111 (GRCm39)), which results in a frameshift and premature stop codon. (J:291216)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Got2 Mutation: 26 strains or lines available

References

• Original: J:291216 van Karnebeek CDM, et al., Bi-allelic GOT2 Mutations Cause a Treatable Malate-Aspartate Shuttle-Related Encephalopathy. Am J Hum Genet. 2019 Sep 5;105(3):534-548
• All: 1 reference(s)