About   Help   FAQ
Klrg1em1Lbro
Endonuclease-mediated Allele Detail
Summary
Symbol: Klrg1em1Lbro
Name: killer cell lectin-like receptor subfamily G, member 1; endonuclease-mediated mutation 1, Laurent Brossay
MGI ID: MGI:7464198
Synonyms: KLRG1-
Gene: Klrg1  Location: Chr6:122247555-122259792 bp, - strand  Genetic Position: Chr6, 57.52 cM
Alliance: Klrg1em1Lbro page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsTwo guide RNAs (ATTGTGGACCATTCAGCTTG and CTTAACTATGTAGTCCAGAC) are designed to target exon 3. Non-homologus endjoining results in the deletion of the sequence between the gRNAs. Klrg1 transcript Klrg1-201 (ENSMUST00000032207.9) was used as reference for exon number and the guide sequences. (J:334818)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Klrg1 Mutation:  27 strains or lines available
References
Original:  J:334818 Tata A, et al., Combination blockade of KLRG1 and PD-1 promotes immune control of local and disseminated cancers. Oncoimmunology. 2021 Jun 15;10(1):1933808
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory