Krt17em1Cou
Endonuclease-mediated Allele Detail
|
Symbol: |
Krt17em1Cou |
Name: |
keratin 17; endonuclease-mediated mutation 1, Pierre A Coulombe |
MGI ID: |
MGI:7464110 |
Synonyms: |
Krt17deltaNLS |
Gene: |
Krt17 Location: Chr11:100147043-100151855 bp, - strand Genetic Position: Chr11, 63.44 cM
|
Alliance: |
Krt17em1Cou page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Hypomorph) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: The nuclear localization signal sequence was targeted with an sgRNA (targeting GTACAAGCCAAAAGAACGTAAGG) and an ssODN template (GCATTAGGGGTGAGGAAGGTACTCTCGGATTTCATCTAATCTCTCCAACTTTTTTTTTCCAGCCTGACTCAGTACGCGCCAGCAGAACGTAAGGATATTGGTAACTGAGGGCTGGGGTAGAAGGATGCATGTGGCAGGAATCGCCTAGCAGATTGCTAGG) using CRISPR/Cas9 technology, resulting in lysine codon 399 (AAG) to alanine (GCG) (K399A) and lysine codon 401 (AAA) to alanine (GCA) (K401A) mutations. These mutations destroy the NLS.
(J:331728)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Krt17 Mutation: |
26 strains or lines available
|
|
Original: |
J:331728 Jacob JT, et al., Keratin 17 regulates nuclear morphology and chromatin organization. J Cell Sci. 2020 Oct 30;133(20):jcs254094 |
All: |
2 reference(s) |
|