Map10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Map10^em1(IMPC)J
• Name: microtubule-associated protein 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7463972
• Gene: Map10 Location: Chr8:126396557-126400098 bp, + strand Genetic Position: Chr8, 73.65 cM, cytoband E2
• Alliance: Map10^em1(IMPC)J page
• IMPC: Map10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GCAATGGCGACCACGGCGGC and GCAGATGTCTTTGCACTGTC that targeted exon(s) ENSMUSE00001559330.1 ENSMUSE00000346397.5. This resulted in deletion(s) of 2 bp (location: Chr8:126396435-126396436; GRCm39), 2611 bp (location: Chr8:126396621-126399231; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Map10 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)