Map10em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Map10em1(IMPC)J |
| Name: |
microtubule-associated protein 10; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7463972 |
| Gene: |
Map10 Location: Chr8:126396557-126400098 bp, + strand Genetic Position: Chr8, 73.65 cM, cytoband E2
|
| Alliance: |
Map10em1(IMPC)J page
|
| IMPC: |
Map10 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAATGGCGACCACGGCGGC and GCAGATGTCTTTGCACTGTC, which resulted in a 2611 bp deletion beginning at Chromosome 8 position 125,669,882 bp and ending after 125,672,492 bp (GRCm38/mm10). This mutation deletes 2611 bp of ENSMUSE00000346397 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 5 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|