About   Help   FAQ
Map10em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Map10em1(IMPC)J
Name: microtubule-associated protein 10; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7463972
Gene: Map10  Location: Chr8:126396557-126400098 bp, + strand  Genetic Position: Chr8, 73.65 cM, cytoband E2
Alliance: Map10em1(IMPC)J page
IMPC: Map10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAATGGCGACCACGGCGGC and GCAGATGTCTTTGCACTGTC, which resulted in a 2611 bp deletion beginning at Chromosome 8 position 125,669,882 bp and ending after 125,672,492 bp (GRCm38/mm10). This mutation deletes 2611 bp of ENSMUSE00000346397 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Map10 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/28/2023
MGI 6.22
The Jackson Laboratory