About   Help   FAQ
Atosbem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Atosbem1(IMPC)J
Name: atos homolog B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7463966
Gene: Atosb  Location: Chr4:43032414-43046220 bp, - strand  Genetic Position: Chr4, 22.99 cM
Alliance: Atosbem1(IMPC)J page
IMPC: Atosb gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCCAGCCTAAGATCTCAT and GCAGAGCTTGTCCCAAAGCG, which resulted in a 4988 bp deletion beginning at Chromosome 4 position 43,032,325 bp and ending after 43,037,312 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000362071, ENSMUSE00000342963, ENSMUSE00000390285, ENSMUSE00001303795, ENSMUSE00001252670, ENSMUSE00001212016, ENSMUSE00001285070, ENSMUSE00001213061 (exons 2-9) and 2031 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Atosb Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
02/20/2024
MGI 6.23
The Jackson Laboratory