Utp11em1(IMPC)Kmpc
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Utp11em1(IMPC)Kmpc |
| Name: |
UTP11 small subunit processome component; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center |
| MGI ID: |
MGI:7462371 |
| Gene: |
Utp11 Location: Chr4:124571953-124587393 bp, - strand Genetic Position: Chr4, 57.87 cM, cytoband D1
|
| Alliance: |
Utp11em1(IMPC)Kmpc page
|
| IMPC: |
Utp11 gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences ACCTACTACGGTGGTGCTTG and AGAGTTCATCACCCACTCGC that targeted exon(s) ENSMUSE00001255441.2. This resulted in deletion(s) of 639 bp (location: Chr4:124579481-124580119; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Utp11 Mutation: |
8 strains or lines available
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
2 reference(s) |
|