Slc22a13^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc22a13^{em1(IMPC)Kmpc}
• Name: solute carrier family 22 (organic cation transporter), member 13; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7462365
• Gene: Slc22a13 Location: Chr9:119022040-119038164 bp, - strand Genetic Position: Chr9, 71.33 cM
• Alliance: Slc22a13^{em1(IMPC)Kmpc} page
• IMPC: Slc22a13 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences AACATACTCATGTTACCAGC and AGAGCCCTAAAACTACCTGT that targeted exon(s) ENSMUSE00000220275.2 ENSMUSE00000965226.2. This resulted in deletion(s) of 569 bp (location: Chr9:119024991-119025559; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc22a13 Mutation: 18 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)