About   Help   FAQ
Armc10em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Armc10em1(IMPC)J
Name: armadillo repeat containing 10; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7461753
Gene: Armc10  Location: Chr5:21851004-21867697 bp, + strand  Genetic Position: Chr5, 9.97 cM, cytoband A3
Alliance: Armc10em1(IMPC)J page
IMPC: Armc10 gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTAGCGCCTCCCCTCCCAC and GGATAGCTAAGAGTTCAGAA, which resulted in a 482 bp deletion beginning at Chromosome 5 position 21,648,332 bp and ending after 21,648,813 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000602887 (exon 2) and 333 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 4 amino acids later. There is a 7 bp (CCCCCCC) insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Armc10 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory