Armc10em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Armc10em1(IMPC)J |
| Name: |
armadillo repeat containing 10; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7461753 |
| Gene: |
Armc10 Location: Chr5:21851004-21867697 bp, + strand Genetic Position: Chr5, 9.97 cM, cytoband A3
|
| Alliance: |
Armc10em1(IMPC)J page
|
| IMPC: |
Armc10 gene page |
|
| Strain of Origin: |
Not Applicable
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTAGCGCCTCCCCTCCCAC and GGATAGCTAAGAGTTCAGAA, which resulted in a 482 bp deletion beginning at Chromosome 5 position 21,648,332 bp and ending after 21,648,813 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000602887 (exon 2) and 333 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 4 amino acids later. There is a 7 bp (CCCCCCC) insertion at the deletion site.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|