Tmem230^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem230^{em1(IMPC)Kmpc}
• Name: transmembrane protein 230; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7461563
• Gene: Tmem230 Location: Chr2:132081412-132089708 bp, - strand Genetic Position: Chr2, 64.15 cM
• Alliance: Tmem230^{em1(IMPC)Kmpc} page
• IMPC: Tmem230 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences AAGCTACCATGGGTAGCATG and GAGTTGTGAAGCTAACTGTC that targeted exon(s) ENSMUSE00000168577.2 ENSMUSE00000682979.2 ENSMUSE00000682980.2 ENSMUSE00000997787.2 ENSMUSE00001281318.2. This resulted in deletion(s) of 5890 bp (location: Chr2:132082200-132088089; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem230 Mutation: 14 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)