Tmem176aem1(IMPC)Kmpc
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tmem176aem1(IMPC)Kmpc |
| Name: |
transmembrane protein 176A; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center |
| MGI ID: |
MGI:7461559 |
| Gene: |
Tmem176a Location: Chr6:48818417-48822298 bp, + strand Genetic Position: Chr6, 23.75 cM
|
| Alliance: |
Tmem176aem1(IMPC)Kmpc page
|
| IMPC: |
Tmem176a gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences CCTGTGACTAAAAGCGCCAC, CTCTTCACCCAACCTCTGAT, GCAATTATCTCTTCCCTACC, and GCTTCTTTGGATAGGAACAT that targeted exon(s) ENSMUSE00000134552.4 ENSMUSE00000134553.4 ENSMUSE00000134554.4 ENSMUSE00000293438.5 ENSMUSE00000341071.4 ENSMUSE00001904035.1 ENSMUSE00001904815.1 ENSMUSE00001904819.1 ENSMUSE00001904820.1 ENSMUSE00001904822.1. This resulted in deletion(s) of 3199 bp (location: Chr6:48818710-48821908; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Tmem176a Mutation: |
14 strains or lines available
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
3 reference(s) |
|