Slc45a4^{em1(IMPC)Kmpc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc45a4^{em1(IMPC)Kmpc}
• Name: solute carrier family 45, member 4; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center
• MGI ID: MGI:7461556
• Gene: Slc45a4 Location: Chr15:73449273-73517611 bp, - strand Genetic Position: Chr15, 34.02 cM
• Alliance: Slc45a4^{em1(IMPC)Kmpc} page
• IMPC: Slc45a4 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Korea Mouse Phenotype Consortium using Cas9 and guides with spacer sequences CAGTGGAGTCGGCAGCCAGA and GTCCCTTACACAGGGTTATG that targeted exon(s) ENSMUSE00000648697.2. This resulted in deletion(s) of 1155 bp (location: Chr15:73457850-73459004; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc45a4 Mutation: 41 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)