Eln^em1Mech
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eln^em1Mech
• Name: elastin; endonuclease-mediated mutation 1, Robert Mechan
• MGI ID: MGI:7451219
• Synonyms: Eln^f
• Gene: Eln Location: Chr5:134731447-134776177 bp, - strand Genetic Position: Chr5, 74.76 cM
• Alliance: Eln^em1Mech page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 genome editing technology was used with two guide RNAs (cggtcccccactgagaactcagg and gatgttggtcctacaagactggg) to insert loxP sites upstream of exon 4 and downstream of exon 29. Gene ID: 13717; NM_007925 is used as reference for exon number and the guide sequences. (J:298415)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Eln Mutation: 41 strains or lines available

References

• Original: J:298415 Lin CJ, et al., Heterogeneous Cellular Contributions to Elastic Laminae Formation in Arterial Wall Development. Circ Res. 2019 Nov 8;125(11):1006-1018
• All: 4 reference(s)