Tpcn2^em1Lwbch
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tpcn2^em1Lwbch
• Name: two pore segment channel 2; endonuclease-mediated mutation 1, Wei Li
• MGI ID: MGI:7450918
• Synonyms: Tpcn2 R194C knock-in
• Gene: Tpcn2 Location: Chr7:144740261-144837748 bp, - strand Genetic Position: Chr7, 89.02 cM
• Alliance: Tpcn2^em1Lwbch page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 194 (CGG) in exon 6 was changed to cysteine (TGC) (p.R194C) using an sgRNA (targeting AGAAGACCCTGAAGTGTATACGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.R210C mutation found in an albinism patient. (J:332654)
• Inheritance: Dominant

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tpcn2 Mutation: 50 strains or lines available

References

• Original: J:332654 Wang Q, et al., A gain-of-function TPC2 variant R210C increases affinity to PI(3,5)P(2) and causes lysosome acidification and hypopigmentation. Nat Commun. 2023 Jan 14;14(1):226
• All: 1 reference(s)