About   Help   FAQ
Tpcn2em1Lwbch
Endonuclease-mediated Allele Detail
Summary
Symbol: Tpcn2em1Lwbch
Name: two pore segment channel 2; endonuclease-mediated mutation 1, Wei Li
MGI ID: MGI:7450918
Synonyms: Tpcn2 R194C knock-in
Gene: Tpcn2  Location: Chr7:144740261-144837748 bp, - strand  Genetic Position: Chr7, 89.02 cM
Alliance: Tpcn2em1Lwbch page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 194 (CGG) in exon 6 was changed to cysteine (TGC) (p.R194C) using an sgRNA (targeting AGAAGACCCTGAAGTGTATACGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.R210C mutation found in an albinism patient. (J:332654)
Inheritance:    Dominant
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tpcn2 Mutation:  53 strains or lines available
References
Original:  J:332654 Wang Q, et al., A gain-of-function TPC2 variant R210C increases affinity to PI(3,5)P(2) and causes lysosome acidification and hypopigmentation. Nat Commun. 2023 Jan 14;14(1):226
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory