Cfap100em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cfap100em1(IMPC)J |
| Name: |
cilia and flagella associated protein 100; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7450836 |
| Gene: |
Cfap100 Location: Chr6:90380461-90405779 bp, - strand Genetic Position: Chr6, 40.16 cM
|
| Alliance: |
Cfap100em1(IMPC)J page
|
| IMPC: |
Cfap100 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTGGCAGGAACACAGGGG and CTAAAATCAAGATCCAGCAG, which resulted in a 349 bp deletion beginning at Chromosome 6 position 90,412,077 bp and ending after 90,412,425 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001260855 and ENSMUSE00000452276 (exons 10 and 11) and 180 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 308 and early truncation 28 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|