About   Help   FAQ
Cfap100em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cfap100em1(IMPC)J
Name: cilia and flagella associated protein 100; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7450836
Gene: Cfap100  Location: Chr6:90380461-90405779 bp, - strand  Genetic Position: Chr6, 40.16 cM
Alliance: Cfap100em1(IMPC)J page
IMPC: Cfap100 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTGGCAGGAACACAGGGG and CTAAAATCAAGATCCAGCAG, which resulted in a 349 bp deletion beginning at Chromosome 6 position 90,412,077 bp and ending after 90,412,425 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001260855 and ENSMUSE00000452276 (exons 10 and 11) and 180 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 308 and early truncation 28 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cfap100 Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory