About   Help   FAQ
Nubplem1Vkim
Endonuclease-mediated Allele Detail
Summary
Symbol: Nubplem1Vkim
Name: nucleotide binding protein-like; endonuclease-mediated mutation 1, Virginia Kimonis
MGI ID: MGI:7449244
Synonyms: NubplL104P
Gene: Nubpl  Location: Chr12:52144529-52357753 bp, + strand  Genetic Position: Chr12, 22.11 cM, cytoband C1
Alliance: Nubplem1Vkim page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsLeucine codon 104 (TTA) in exon 4 was changed to proline (CCA) (p.L104P) using gRNAs (targeting GGCGGTTGGCTTGTTAGATGTGG and CCAAGGCGGTTGGCTTGTTAGAT) and an ssODN template (AACCTGATGAATAATCTTTTGATGATTTTGGTTTTCTTGCAGTCTAAAGCCGTTGGCTTGCCAGACGTCGAcGTGTATGGTCCTTCCATTCCAAAGATGATGAACCTGAGAGGAAATCCA) with CRISPR/Cas9 technology. The orthologous human mutation is associated with mitochondrial complex I deficiency disorder. (J:333699)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nubpl Mutation:  19 strains or lines available
References
Original:  J:333699 Cheng C, et al., Early embryonic lethality in complex I associated p.L104P Nubpl mutant mice. Orphanet J Rare Dis. 2022 Oct 24;17(1):386
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory