Nubplem1Vkim
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Nubplem1Vkim |
| Name: |
nucleotide binding protein-like; endonuclease-mediated mutation 1, Virginia Kimonis |
| MGI ID: |
MGI:7449244 |
| Synonyms: |
NubplL104P |
| Gene: |
Nubpl Location: Chr12:52144529-52357753 bp, + strand Genetic Position: Chr12, 22.11 cM, cytoband C1
|
| Alliance: |
Nubplem1Vkim page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Specified) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Leucine codon 104 (TTA) in exon 4 was changed to proline (CCA) (p.L104P) using gRNAs (targeting GGCGGTTGGCTTGTTAGATGTGG and CCAAGGCGGTTGGCTTGTTAGAT) and an ssODN template (AACCTGATGAATAATCTTTTGATGATTTTGGTTTTCTTGCAGTCTAAAGCCGTTGGCTTGCCAGACGTCGAcGTGTATGGTCCTTCCATTCCAAAGATGATGAACCTGAGAGGAAATCCA) with CRISPR/Cas9 technology. The orthologous human mutation is associated with mitochondrial complex I deficiency disorder.
(J:333699)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Nubpl Mutation: |
19 strains or lines available
|
|
| Original: |
J:333699 Cheng C, et al., Early embryonic lethality in complex I associated p.L104P Nubpl mutant mice. Orphanet J Rare Dis. 2022 Oct 24;17(1):386 |
| All: |
1 reference(s) |
|