About   Help   FAQ
Rr364729em1Almk
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr364729em1Almk
Name: regulatory region 364729; endonuclease-mediated mutation 1, Alasdair MacKenzie
MGI ID: MGI:7448757
Synonyms: mGAL5.1KO
Gene: Rr364729  Location: Chr19:3490401-3491799 bp  Genetic Position: Chr19, Syntenic
Alliance: Rr364729em1Almk page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThe Gal enhancer was targeted with sgRNAs (targeting CTCCCTGGAGCAATATGAAG and CCCGCTTTCATGGCTCCCAA) using CRISPR/Cas9 technology, resulting in a 257 bp deletion (chr19:3490919-3491175 (GRCm39)). The orthologous human enhancer is implied in male anxiety and ethanol intake. (J:334339)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr364729 Mutation:  0 strains or lines available
References
Original:  J:334339 McEwan AR, et al., CRISPR disruption and UK Biobank analysis of a highly conserved polymorphic enhancer suggests a role in male anxiety and ethanol intake. Mol Psychiatry. 2021 Jun;26(6):2263-2276
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory