Rpl39l^em#Jsha
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rpl39l^em#Jsha
• Name: ribosomal protein L39-like; endonuclease-mediated mutation, Jiahao Sha
• MGI ID: MGI:7448473
• Synonyms: Ribosome^ST-
• Gene: Rpl39l Location: Chr16:9988090-9992775 bp, + strand Genetic Position: Chr16, 5.49 cM, cytoband A3
• Alliance: Rpl39l^em#Jsha page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR targeting of exon 3 using sgRNAs AAATCGTCCCATTCCACAATGG and GAAGGTCTTGTGAGAAGCCATG produced small deletions. Three mouse lines, with a 1-bp, 11-bp, and 13-bp deletions were generated. The pound (#) in the allele symbol is used for this pooled allele. (J:333015)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rpl39l Mutation: 4 strains or lines available

References

• Original: J:333015 Li H, et al., A male germ-cell-specific ribosome controls male fertility. Nature. 2022 Dec;612(7941):725-731
• All: 1 reference(s)