About   Help   FAQ
Rr253em4Kmm
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr253em4Kmm
Name: regulatory region 253; endonuclease-mediated mutation 4, Kenneth M Murphy
MGI ID: MGI:7448465
Synonyms: delta1+2
Gene: Rr253  Location: Chr2:45169490-45169853 bp  Genetic Position: Chr2, Syntenic
Alliance: Rr253em4Kmm page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsUsing zygotes that already carry the Rr253em3Kmm NFIL3C/EBP binding site 1-deletion allele, binding sites 2 and 3 in the Zeb2 enhancer, located ~165 kb upstream, were targeted with sgRNAs (targeting ATTTTGCAACCCCCCAAAAA and CCGGTGACACACACTGCTCA) and an ssODN template (TGGGGGAATGAATCATCAAAATAACCGGTGGAAAACAAGCTAGATCTGAGTTGAGCAGTGTGTGTCACCGGCTGGTGGAATTTTTAGAAAGGCAGCAGTTTGGGCTCATCACTGCGGTTCCTGATTGCACACACCTGTTTGGGGCATGGAGTCGACCTCCCCCCAAAAAGGGGAAACTGAACTCACTGCTCCTCCTGAG) using CRISPR/Cas9 technology, resulting in an allele lacking binding sites 1 and 2. (J:334296)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr253 Mutation:  2 strains or lines available
References
Original:  J:334296 Liu TT, et al., Ablation of cDC2 development by triple mutations within the Zeb2 enhancer. Nature. 2022 Jul;607(7917):142-148
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory