About   Help   FAQ
Rr400em2Pqt
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr400em2Pqt
Name: regulatory region 400; endonuclease-mediated mutation 2, Paul Q Thomas
MGI ID: MGI:7447462
Synonyms: -208
Gene: Rr400  Location: Chr3:87881638-87881892 bp  Genetic Position: Chr3, Syntenic
Alliance: Rr400em2Pqt page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThe Nestin enhancer in intron 2 was targeted with two sgRNAs (targeting TTTGCGGTCTGAAAAGGATT and AGAATCGGCCTCCCTCTCCG) using CRISPR/Cas9 technology, resulting in a 208 bp deletion (chr3:87881630-87881837 (GRCm39)). (J:314040)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr400 Mutation:  0 strains or lines available
References
Original:  J:314040 Thomson E, et al., The Nestin neural enhancer is essential for normal levels of endogenous Nestin in neuroprogenitors but is not required for embryo development. PLoS One. 2021;16(11):e0258538
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory