Polr2jem1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Polr2jem1(IMPC)Bay |
| Name: |
polymerase (RNA) II (DNA directed) polypeptide J; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:7447412 |
| Synonyms: |
Polr2j- |
| Gene: |
Polr2j Location: Chr5:136145545-136151801 bp, + strand Genetic Position: Chr5, 75.8 cM, cytoband G1
|
| Alliance: |
Polr2jem1(IMPC)Bay page
|
| IMPC: |
Polr2j gene page |
|
Polr2jem1(IMPC)Bay/Polr2jem1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as dying morulae or blastocysts. Mutants fail to hatch from the zona pellucida and die after 3 days in culture.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences CCTCCGAGGAGCTAAGACGA and GGCAACGGTGGTTTTGTGCT that targeted exon(s) ENSMUSE00000241550.2 ENSMUSE00000686759.2 ENSMUSE00002188869.1. This resulted in deletion(s) of 446 bp (location: Chr5:136150830-136151275; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
4 reference(s) |
|