Ranbp3l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ranbp3l^em1(IMPC)J
• Name: RAN binding protein 3-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7447006
• Gene: Ranbp3l Location: Chr15:8997433-9067417 bp, + strand Genetic Position: Chr15, 3.82 cM
• Alliance: Ranbp3l^em1(IMPC)J page
• IMPC: Ranbp3l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTAGGCAAAAAGTGAGCAG and CCAGCTGTCCAACATCAGAG, which resulted in a 561 bp deletion beginning at Chromosome 15 position 9,007,125 bp and ending after 9,007,685 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001434081 (exon 7) and 418 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 138 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ranbp3l Mutation: 37 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)