About   Help   FAQ
Gatmem1Rcch
Endonuclease-mediated Allele Detail
Summary
Symbol: Gatmem1Rcch
Name: glycine amidinotransferase (L-arginine:glycine amidinotransferase); endonuclease-mediated mutation 1, Rongchang Chen
MGI ID: MGI:7443161
Gene: Gatm  Location: Chr2:122424954-122441758 bp, - strand  Genetic Position: Chr2, 60.63 cM
Alliance: Gatmem1Rcch page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 technology using sgRNA CCAAAGATCATCTGAAGAAGG targeting exon 3 of the Gatm-201 transcript generated a 2 bp (TC) insertion resulting in a frameshift mutation. (J:333911)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gatm Mutation:  22 strains or lines available
References
Original:  J:333911 Yu L, et al., Reprogramming alternative macrophage polarization by GATM-mediated endogenous creatine synthesis: A potential target for HDM-induced asthma treatment. Front Immunol. 2022;13:937331
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory