Gatm^em1Rcch
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gatm^em1Rcch
• Name: glycine amidinotransferase (L-arginine:glycine amidinotransferase); endonuclease-mediated mutation 1, Rongchang Chen
• MGI ID: MGI:7443161
• Gene: Gatm Location: Chr2:122424954-122441758 bp, - strand Genetic Position: Chr2, 60.63 cM
• Alliance: Gatm^em1Rcch page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNA CCAAAGATCATCTGAAGAAGG targeting exon 3 of the Gatm-201 transcript generated a 2 bp (TC) insertion resulting in a frameshift mutation. (J:333911)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gatm Mutation: 22 strains or lines available

References

• Original: J:333911 Yu L, et al., Reprogramming alternative macrophage polarization by GATM-mediated endogenous creatine synthesis: A potential target for HDM-induced asthma treatment. Front Immunol. 2022;13:937331
• All: 1 reference(s)